MXSCARNA (Multiplex Stem Candidate Aligner for RNAs) is a multiple alignment tool for RNA sequences using progressive alignment based on pairwise structural alignment algorithm of SCARNA. This software is fast enough for large scale analyses, while the accuracies of the alignments are better than or comparable with the existing algorithms which are computationally much more expensive in time and memory. Developed by Computational Biology Research Center (CBRC), AIST. To view the diagrams, this system needs SVG plug-in. The plug-in is freely available at www.adobe.com .
You can cut and paste or type multiple sequence into the large text window. A FASTA format sequence is simply a block of characters representing a RNA sequence (A, T, G, C and U). For details of FASTA format, see cahpter 3.
You can input sample data by clicking "Input sample" button.
You may upload a file from your computer which containing a valid sequence in any multi FASTA format, using this option. Please note that this option only works with Internet Explorer version 5 or later. Some word processors may yield unpredictable results as hidden/control characters may be present in the files. It is best to save files with the Unix format option to avoid hidden windows characters.
You can set parameters of mxscarna program.

System will not understand other than FASTA format.
You can select following display mode using list box.
Multiple alignment of input sequences including annotations of common secondary structure is displayed.
Common secondary structure of input sequences is displayed as SVG image. You can select sequcences to be displayed using check box in alignment table.
Phylogenetic tree of input sequences is displayed. Both rooted and unrooted tree can be displayed.
Fasta files containing multiple sequences are just the same, with one sequence listed right after another. This format is accepted for many multiple sequence alignment programs.
>AE000930.1/11782-11855 GCGCCGCCCUUGCAAGGCGGAGGCCCCGGGUUCAAAUCCCGGUGGGUCC >M32222.1/3110-3183 GCGCCGCCCUUGCAAGGCGGAGGCCCCGGGUUCAAAUCCCGGUGGGUCC >U67528.1/1042-969 CUGCCUGCUUGGUAAGCAGGAGGUCGCGGGUUCAAACCCCGCCCGAGGC |
|---|