About this Web service

MXSCARNA (Multiplex Stem Candidate Aligner for RNAs) is a multiple alignment
tool for RNA sequences using progressive alignment based on pairwise 
structural alignment algorithm of SCARNA. This software is fast enough for
large scale analyses, while the accuracies of the alignments are better than
or comparable with the existing algorithms which are computationally much
more expensive in time and memory. 
Developed by Computational Biology Research Center (CBRC), AIST.

To view the diagrams, this system needs SVG plug-in. 
The plug-in is freely available at www.adobe.com .

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

1 Input query

1.1 Sequence Input methods


 

1.1.1 Direct input

You can cut and paste or type multiple sequence into the large text window.
A FASTA format sequence is simply a block of characters representing a RNA 
sequence (A, T, G, C and U). For details of FASTA format, see cahpter 3.

 

1.1.2 Sample data

You can input sample data by clicking "Input sample" button. 

 

1.1.3 File Upload

You may upload a file from your computer which containing a valid sequence 
in any multi FASTA format, using this option. 
Please note that this option only works with Internet Explorer version 5 or later. 

Some word processors may yield unpredictable results as hidden/control
characters may be present 

in the files. It is best to save files with the Unix format option to avoid hidden
windows characters.

 

1.2 Parameter set

You can set parameters of mxscarna program.

 

1.3 Limitation

System will not understand other than FASTA format.

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

2 Results

2.1 Display mode

You can select following display mode using list box.

 

 

2.1.1 Alignment

Multiple alignment of input sequences including annotations of common 
secondary structure is displayed. 

 

2.2 Secondary structure

Common secondary structure of input sequences is displayed as SVG image. 
You can select sequcences to be displayed using check box in alignment table.

 

2.3 Phylogenetic tree

Phylogenetic tree of input sequences is displayed. 
Both rooted and unrooted tree can be displayed. 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

3 FASTA format

Fasta files containing multiple sequences are just the same, with one sequence 
listed right after another.

This format is accepted for many multiple sequence alignment programs. 

 

>AE000930.1/11782-11855 GCGCCGCCCUUGCAAGGCGGAGGCCCCGGGUUCAAAUCCCGGUGGGUCC >M32222.1/3110-3183 GCGCCGCCCUUGCAAGGCGGAGGCCCCGGGUUCAAAUCCCGGUGGGUCC >U67528.1/1042-969 CUGCCUGCUUGGUAAGCAGGAGGUCGCGGGUUCAAACCCCGCCCGAGGC